Chapter 20 Dna Technology and Genomics Guided Reading

Chapter 20 DNA Technology and Genomics Power. Point Lectures for Biology, Seventh Edition Neil

Chapter 20 DNA Technology and Genomics Power. Point Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Overview: Understanding and Manipulating Genomes • One of the greatest achievements of

• Overview: Understanding and Manipulating Genomes • One of the greatest achievements of modern science – Has been the sequencing of the human genome, which was largely completed by 2003 • DNA sequencing accomplishments – Have all depended on advances in DNA technology, starting with the invention of methods for making recombinant DNA Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• DNA technology has launched a revolution in the area of biotechnology –

• DNA technology has launched a revolution in the area of biotechnology – The manipulation of organisms or their genetic components to make useful products • An example of DNA technology is the microarray – A measurement of gene expression of thousands of different genes Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Concept 20. 1: DNA cloning permits production of multiple copies of a

• Concept 20. 1: DNA cloning permits production of multiple copies of a specific gene or other DNA segment • To work directly with specific genes – Scientists have developed methods for preparing well-defined, gene-sized pieces of DNA in multiple identical copies, a process called gene cloning Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

DNA Cloning and Its Applications: A Preview • Most methods for cloning pieces of

DNA Cloning and Its Applications: A Preview • Most methods for cloning pieces of DNA in the laboratory – Share certain general features, such as the use of bacteria and their plasmids Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Overview of gene cloning with a bacterial plasmid, showing various uses of

• Overview of gene cloning with a bacterial plasmid, showing various uses of cloned genes Bacterium Cell containing gene 1 Gene inserted of interest into plasmid Plasmid Bacterial chromosome Recombinant DNA (plasmid) Gene of interest 2 Plasmid put into bacterial cell Recombinate bacterium 3 Host cell grown in culture, to form a clone of cells containing the "cloned" gene of interest Gene of interest Protein expressed by gene of interest Protein harvested Copies of gene Basic research on gene Figure 20. 2 DNA of chromosome 4 Basic research and various applications Basic research on protein Gene used to alter Human growth Gene for pest Protein dissolves resistance inserted bacteria for cleaning blood clots in heart hormone treats up toxic waste stunted growth into plants attack therapy Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Using Restriction Enzymes to Make Recombinant DNA • Bacterial restriction enzymes – Cut DNA

Using Restriction Enzymes to Make Recombinant DNA • Bacterial restriction enzymes – Cut DNA molecules at a limited number of specific DNA sequences, called restriction sites Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• A restriction enzyme will usually make many cuts in a DNA molecule

• A restriction enzyme will usually make many cuts in a DNA molecule – Yielding a set of restriction fragments • The most useful restriction enzymes cut DNA in a staggered way – Producing fragments with "sticky ends" that can bond with complementary "sticky ends" of other fragments • DNA ligase is an enzyme – That seals the bonds between restriction fragments Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Using a restriction enzyme and DNA ligase to make recombinant DNA Restriction

• Using a restriction enzyme and DNA ligase to make recombinant DNA Restriction site DNA 5 3 3 5 GAATTC CTTAAG 1 Restriction enzyme cuts the sugar-phosphate backbones at each arrow AATTC G CTTAA G Sticky end AATTC 2 DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. G AATT C C TTAA G G Fragment from different DNA molecule cut by the same restriction enzyme G AATTC CTTAA G One possible combination 3 DNA ligase seals the strands. Figure 20. 3 Recombinant DNA molecule Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings G CTTAA

Cloning a Eukraryotic Gene in a Bacterial Plasmid • In gene cloning, the original

Cloning a Eukraryotic Gene in a Bacterial Plasmid • In gene cloning, the original plasmid is called a cloning vector – Defined as a DNA molecule that can carry foreign DNA into a cell and replicate there Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Producing Clones of Cells APPLICATION Cloning is used to prepare many copies of a

Producing Clones of Cells APPLICATION Cloning is used to prepare many copies of a gene of interest for use in sequencing the gene, in producing its encoded protein, in gene therapy, or in basic research. TECHNIQUE In this example, a human gene is inserted into a plasmid from E. coli. The plasmid contains the amp. R gene, which makes E. coli cells resistant to the antibiotic ampicillin. It also contains the lac. Z gene, which encodes -galactosidase. This enzyme hydrolyzes a molecular mimic of lactose (X-gal) to form a blue product. Only three plasmids and three human DNA fragments are shown, but millions of copies of the plasmid and a mixture of millions of different human DNA fragments would be present in the samples. 1 Isolate plasmid DNA and human DNA. 2 Cut both DNA samples with the same restriction enzyme 3 Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. Figure 20. 4 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings lac. Z gene (lactose Human breakdown) cell Bacterial cell Restriction site amp. R gene (ampicillin resistance) Bacterial plasmid Gene of interest Sticky ends Recombinant DNA plasmids Human DNA fragments

4 Introduce the DNA into bacterial cells that have a mutation in their own

4 Introduce the DNA into bacterial cells that have a mutation in their own lac. Z gene. Recombinant bacteria 5 Plate the bacteria on agar containing ampicillin and X-gal. Incubate until colonies grow. Colony carrying nonrecombinant plasmid with intact lac. Z gene Colony carrying recombinant plasmid with disrupted lac. Z gene Bacterial clone RESULTS Only a cell that took up a plasmid, which has the amp. R gene, will reproduce and form a colony. Colonies with nonrecombinant plasmids will be blue, because they can hydrolyze X-gal. Colonies with recombinant plasmids, in which lac. Z is disrupted, will be white, because they cannot hydrolyze X-gal. By screening the white colonies with a nucleic acid probe (see Figure 20. 5), researchers can identify clones of bacterial cells carrying the gene of interest. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Identifying Clones Carrying a Gene of Interest • A clone carrying the gene of

Identifying Clones Carrying a Gene of Interest • A clone carrying the gene of interest – Can be identified with a radioactively labeled nucleic acid probe that has a sequence complementary to the gene, a process called nucleic acid hybridization Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Nucleic acid probe hybridization APPLICATION Hybridization with a complementary nucleic acid probe

• Nucleic acid probe hybridization APPLICATION Hybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest. TECHNIQUE Cells from each colony known to contain recombinant plasmids (white colonies in Figure 20. 4, stap 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This collection of bacterial colonies is the master plate. Master plate Probe DNA Solution containing probe Radioactive single-stranded DNA Gene of interest Single-stranded DNA from cell Filter Colonies containing gene of interest Film Filter lifted and flipped over 1 A special filter paper is pressed against the master plate, transferring cells to the bottom side of the filter. RESULTS Figure 20. 5 2 Hybridization on filter The filter is treated to break open the cells and denature their DNA; the resulting singlestranded DNA molecules are treated so that they stick to the filter. 3 The filter is laid under photographic film, allowing any radioactive areas to expose the film (autoradiography). 4 After the developed film is flipped over, the reference marks on the film and master plate are aligned to locate colonies carrying the gene of interest. Colonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different nucleotide sequences, the collection of bacterial clones can be screened for different genes. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Storing Cloned Genes in DNA Libraries • A genomic library made using bacteria –

Storing Cloned Genes in DNA Libraries • A genomic library made using bacteria – Is the collection of recombinant vector clones produced by cloning DNA fragments derived from an entire genome Foreign genome cut up with restriction enzyme or Recombinant plasmids Bacterial clones Figure 20. 6 (a) Plasmid library Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Recombinant phage DNA Phage clones (b) Phage library

• A genomic library made using bacteriophages – Is stored as a collection

• A complementary DNA (c. DNA) library – Is made by cloning DNA

• A complementary DNA (c. DNA) library – Is made by cloning DNA made in vitro by reverse transcription of all the m. RNA produced by a particular cell Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Cloning and Expressing Eukaryotic Genes • As an alternative to screening a DNA library

Cloning and Expressing Eukaryotic Genes • As an alternative to screening a DNA library for a particular nucleotide sequence – The clones can sometimes be screened for a desired gene based on detection of its encoded protein Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Bacterial Expression Systems • Several technical difficulties – Hinder the expression of cloned eukaryotic

Bacterial Expression Systems • Several technical difficulties – Hinder the expression of cloned eukaryotic genes in bacterial host cells • To overcome differences in promoters and other DNA control sequences – Scientists usually employ an expression vector, a cloning vector that contains a highly active prokaryotic promoter Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Eukaryotic Cloning and Expression Systems • The use of cultured eukaryotic cells as host

Eukaryotic Cloning and Expression Systems • The use of cultured eukaryotic cells as host cells and yeast artificial chromosomes (YACs) as vectors – Helps avoid gene expression problems Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) • The polymerase chain reaction,

Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) • The polymerase chain reaction, PCR – Can produce many copies of a specific target segment of DNA – Uses primers that bracket the desired sequence – Uses a heat-resistant DNA polymerase Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• The PCR procedure APPLICATION With PCR, any specific segment—the target sequence—within a

• The PCR procedure APPLICATION With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro. TECHNIQUE The starting materials for PCR are doublestranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, single-stranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence. RESULTS During each PCR cycle, the target DNA sequence is doubled. By the end of the third cycle, one-fourth of the molecules correspond exactly to the target sequence, with both strands of the correct length (see white boxes above). After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more. Figure 20. 7 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Genomic DNA 1 Denaturation: 5 3 Target sequence 3 5 5 3 3 5 Heat briefly to separate DNA strands 2 Annealing: Cycle 1 yields 2 molecules Cool to allow primers to Primers hydrogen-bond. 3 Extension: DNA polymerase adds nucleotides to the 3 end of each primer Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence New nucleotides

• Concept 20. 2: Restriction fragment analysis detects DNA differences that affect restriction

• Concept 20. 2: Restriction fragment analysis detects DNA differences that affect restriction sites • Restriction fragment analysis – Can rapidly provide useful comparative information about DNA sequences Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Gel Electrophoresis and Southern Blotting • Gel electrophoresis – Separates DNA restriction fragments of

Gel Electrophoresis and Southern Blotting • Gel electrophoresis – Separates DNA restriction fragments of different lengths APPLICATION Gel electrophoresis is used for separating nucleic acids or proteins that differ in size, electrical charge, or other physical properties. DNA molecules are separated by gel electrophoresis in restriction fragment analysis of both cloned genes (see Figure 20. 9) and genomic DNA (see Figure 20. 10). Cathode 1 Each sample, a mixture of DNA molecules, is placed in a separate well near one end of a thin slab of gel. The gel is supported by glass plates, bathed in an aqueous solution, and has electrodes attached to each end. Power source Mixture of DNA molecules of different sizes Gel Glass plates 2 When the current is turned on, the negatively charged DNA molecules move toward the positive electrode, with shorter molecules moving faster than longer ones. Bands are shown here in blue, but on an actual gel, DNA bands are not visible until a DNA -binding dye is added. The shortest molecules, having traveled farthest, end up in bands at the bottom of the gel. TECHNIQUE RESULTS Figure 20. 8 Gel electrophoresis separates macromolecules on the basis of their rate of movement through a gel in an electric field. How far a DNA molecule travels while the current is on is inversely proportional to its length. A mixture of DNA molecules, usually fragments produced by restriction enzyme digestion, is separated into "bands"; each band contains thousands of molecules of the same length. After the current is turned off, a DNA-binding dye is added. This dye fluoresces pink in ultraviolet light, revealing the separated bands to which it binds. In this actual gel, the pink bands correspond to DNA fragments of different lengths separated by electrophoresis. If all the samples were initially cut with the same restriction enzyme, then the different band patterns indicate that they came from different sources. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Anode Longer molecules Shorter molecules

• Restriction fragment analysis – Is useful for comparing two different DNA molecules,

• Restriction fragment analysis – Is useful for comparing two different DNA molecules, such as two alleles for a gene Normal -globin allele 201 bp 175 bp Dde. I Large fragment Dde. I Sickle-cell mutant -globin allele Large fragment 376 bp Dde. I (a) Dde. I restriction sites in normal and sickle-cell alleles of -globin gene. Normal allele Sickle-cell allele Large fragment 376 bp 201 bp 175 bp Figure 20. 9 a, b (b) Electrophoresis of restriction fragments from normal and sickle-cell alleles. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Specific DNA fragments can be identified by Southern blotting – Using labeled

• Specific DNA fragments can be identified by Southern blotting – Using labeled probes that hybridize to the DNA immobilized on a "blot" of the gel Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Southern blotting of DNA fragments APPLICATION Researchers can detect specific nucleotide sequences

• Southern blotting of DNA fragments APPLICATION Researchers can detect specific nucleotide sequences within a DNA sample with this method. In particular, Southern blotting is useful for comparing the restriction fragments produced from different samples of genomic DNA. TECHNIQUE In this example, we compare genomic DNA samples from three individuals: a homozygote for the normal -globin allele (I), a homozygote for the mutant sickle-cell allele (II), and a heterozygote (III). DNA + restriction enzyme Restriction fragments I II III Nitrocellulose paper (blot) Heavy weight Gel Sponge I Normal -globin allele Alkaline solution II Sickle-cell III Heterozygote allele 1 Preparation of restriction fragments. 2 Gel electrophoresis. Figure 20. 10 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings 3 Blotting. Paper towels

Radioactively labeled probe for -globin gene is added to solution in a plastic bag

Radioactively labeled probe for -globin gene is added to solution in a plastic bag I II III Paper blot 1 Hybridization with radioactive probe. RESULTS Probe hydrogenbonds to fragments containing normal or mutant -globin Fragment from sickle-cell -globin allele Fragment from normal -globin allele I II III Film over paper blot 2 Autoradiography. Because the band patterns for the three samples are clearly different, this method can be used to identify heterozygous carriers of the sickle-cell allele (III), as well as those with the disease, who have two mutant alleles (II), and unaffected individuals, who have two normal alleles (I). The band patterns for samples I and II resemble those observed for the purified normal and mutant alleles, respectively, seen in Figure 20. 9 b. The band pattern for the sample from the heterozygote (III) is a combination of the patterns for the two homozygotes (I and II). Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Restriction Fragment Length Differences as Genetic Markers • Restriction fragment length polymorphisms (RFLPs) –

Restriction Fragment Length Differences as Genetic Markers • Restriction fragment length polymorphisms (RFLPs) – Are differences in DNA sequences on homologous chromosomes that result in restriction fragments of different lengths Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Specific fragments – Can be detected analyzed by Southern blotting • The

• Specific fragments – Can be detected analyzed by Southern blotting • The thousands of RFLPs present throughout eukaryotic DNA – Can serve as genetic markers Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Concept 20. 3: Entire genomes can be mapped at the DNA level

• Concept 20. 3: Entire genomes can be mapped at the DNA level • The Human Genome Project – Sequenced the human genome • Scientists have also sequenced genomes of other organisms – Providing important insights of general biological significance Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Genetic (Linkage) Mapping: Relative Ordering of Markers • The initial stage in mapping a

Genetic (Linkage) Mapping: Relative Ordering of Markers • The initial stage in mapping a large genome – Is to construct a linkage map of several thousand genetic markers spaced throughout each of the chromosomes Cytogenetic map Chromosome banding pattern and location of specific genes by fluorescence in situ hybridization (FISH) Chromosome bands Genes located by FISH 1 Genetic (linkage) mapping Ordering of genetic markers such as RFLPs, simple sequence DNA, and other polymorphisms (about 200 per chromosome) 2 Physical mapping Ordering of large overlapping fragments cloned in YAC and BAC vectors, followed by ordering of smaller fragments cloned in phage and plasmid vectors 3 Figure 20. 11 DNA sequencing Determination of nucleotide sequence of each small fragment and assembly of the partial sequences into the complete genome sequence Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Genetic markers Overlapping fragments …GACTTCATCGGTATCGAACT…

• The order of the markers and the relative distances between them on

Physical Mapping: Ordering DNA Fragments • A physical map – Is constructed by cutting

Physical Mapping: Ordering DNA Fragments • A physical map – Is constructed by cutting a DNA molecule into many short fragments and arranging them in order by identifying overlaps – Gives the actual distance in base pairs between markers Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

DNA Sequencing • Relatively short DNA fragments – Can be sequenced by the dideoxy

• Dideoxy chain-termination method for sequencing DNA (template strand) 5 C T G

• Dideoxy chain-termination method for sequencing DNA (template strand) 5 C T G A C T T C G A C A A APPLICATION The sequence of nucleotides in any cloned DNA fragment up to about 800 base pairs in length can be determined rapidly with specialized machines that carry out sequencing reactions and separate the labeled reaction products by length. TECHNIQUE RESULTS This method synthesizes a nested set of DNA strands complementary to the original DNA fragment. Each strand starts with the same primer and ends with a dideoxyribonucleotide (dd. NTP), a modified nucleotide. Incorporation of a dd. NTP terminates a growing DNA strand because it lacks a 3'—OH group, the site for attachment of the next nucleotide (see Figure 16. 12). In the set of strands synthesized, each nucleotide position along the original sequence is represented by strands ending at that point with the complementary dd. NT. Because each type of dd. NTP is tagged with a distinct fluorescent label, the identity of the ending nucleotides of the new strands, and ultimately the entire original sequence, can be determined. The color of the fluorescent tag on each strand indicates the identity of the nucleotide at its end. The results can be printed out as a spectrogram, and the sequence, which is complementary to the template strand, can then be read from bottom to top. (Notice that the sequence here begins after the primer. ) Figure 20. 12 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings 3 5 3 C T G A C T T C G A C A A Primer 3 T G T T Deoxyribonucleotides Dideoxyribonucleotides (fluorescently tagged) 5 DNA polymerase d. ATP d. CTP dd. CTP d. TTP d. GTP dd. GTP P P P G OH dd. G C T G T T dd. A A G C T G T T dd. G A A G C T G T T dd. T G A A G C T G T T Direction of movement of strands Laser Detector G A C T G A A G C H Labeled strands DNA (template strand) dd. C T G T T G dd. C T G A A G C T G T T dd. A C T G A A G C T G T T dd. G A C T G A A G C T G T T 3

• Linkage mapping, physical mapping, and DNA sequencing – Represent the overarching strategy

• Linkage mapping, physical mapping, and DNA sequencing – Represent the overarching strategy of the Human Genome Project • An alternative approach to sequencing whole genomes starts with the sequencing of random DNA fragments – Powerful computer programs would then assemble the resulting very large number of overlapping short sequences into a single continuous sequence Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

1 Cut the DNA from many copies of an entire chromosome into overlapping fragments

1 Cut the DNA from many copies of an entire chromosome into overlapping fragments short enough for sequencing. 2 Clone the fragments in plasmid or phage vectors 3 Sequence each ACGATACTGGT fragment CGCCATCAGT 4 Order the AGTCCGCTATACGA sequences into one overall sequence with computer software. Figure 20. 13 ACGATACTGGT …ATCGCCATCAGTCCGCTATACGATACTGGTCAA… Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Concept 20. 4: Genome sequences provide clues to important biological questions •

• Concept 20. 4: Genome sequences provide clues to important biological questions • In genomics – Scientists study whole sets of genes and their interactions Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Identifying Protein-Coding Genes in DNA Sequences • Computer analysis of genome sequences – Helps

Identifying Protein-Coding Genes in DNA Sequences • Computer analysis of genome sequences – Helps researchers identify sequences that are likely to encode proteins Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Current estimates are that the human genome contains about 25, 000 genes

• Current estimates are that the human genome contains about 25, 000 genes – But the number of human proteins is much larger Table 20. 1 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Comparison of the sequences of

Determining Gene Function • For a gene of unknown function – Experimental inactivation of

Determining Gene Function • For a gene of unknown function – Experimental inactivation of the gene and observation of the resulting phenotypic effects can provide clues to its function Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Studying Expression of Interacting Groups of Genes • DNA microarray assays allow researchers to

Studying Expression of Interacting Groups of Genes • DNA microarray assays allow researchers to compare patterns of gene expression – In different tissues, at different times, or under different conditions Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• DNA microarray assay of gene expression levels APPLICATION With this method, researchers

• DNA microarray assay of gene expression levels APPLICATION With this method, researchers can test thousands of genes simultaneously to determine which ones are expressed in a particular tissue, under different environmental conditions in various disease states, or at different developmental stages. They can also look for coordinated gene expression. Tissue sample TECHNIQUE m. RNA molecules 1 Isolate m. RNA. 2 Make c. DNA by reverse transcription, using fluores-cently labeled nucleotides. Labeled c. DNA molecules (single strands) 3 Apply the c. DNA mixture to a microarray, a microscope slide on which copies of singlestranded DNA fragments from the organism's genes are fixed, a different gene in each spot. The c. DNA hybridizes with any complementary DNA on the microarray. 4 Rinse off excess c. DNA; scan microarray for fluorescence. Each fluorescent spot (yellow) represents a gene expressed in the tissue sample. DNA microarray RESULT The intensity of fluorescence at each spot is a measure of the expression of the gene represented by that spot in the tissue sample. Commonly, two different samples are tested together by labeling the c. DNAs prepared from each sample with a differently colored fluorescence label. The resulting color at a spot reveals the relative levels of expression of a particular gene in the two samples, which may be from different tissues or the same tissue under different conditions. Figure 20. 14 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Size of an actual DNA microarray with all the genes of yeast (6, 400 spots)

Comparing Genomes of Different Species • Comparative studies of genomes from related and widely

Comparing Genomes of Different Species • Comparative studies of genomes from related and widely divergent species – Are providing valuable information in many fields of biology Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Future Directions in Genomics • Genomics – Is the study of entire genomes •

Future Directions in Genomics • Genomics – Is the study of entire genomes • Proteomics – Is the systematic study of all the proteins encoded by a genome • Single nucleotide polymorphisms (SNPs) – Provide useful markers for studying human genetic variation Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Concept 20. 5: The practical applications of DNA technology affect our lives

• Concept 20. 5: The practical applications of DNA technology affect our lives in many ways • Numerous fields are benefiting from DNA technology and genetic engineering Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Medical Applications • One obvious benefit of DNA technology – Is the identification of

Medical Applications • One obvious benefit of DNA technology – Is the identification of human genes whose mutation plays a role in genetic diseases Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Diagnosis of Diseases • Medical scientists can now diagnose hundreds of human genetic disorders

Diagnosis of Diseases • Medical scientists can now diagnose hundreds of human genetic disorders – By using PCR and primers corresponding to cloned disease genes, then sequencing the amplified product to look for the diseasecausing mutation Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Even when a disease gene has not yet been cloned – The

• Even when a disease gene has not yet been cloned – The presence of an abnormal allele can be diagnosed with reasonable accuracy if a closely linked RFLP marker has been found RFLP marker DNA Restriction sites Disease-causing allele Normal allele Figure 20. 15 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Human Gene Therapy • Gene therapy – Is the alteration of an afflicted individual's

Human Gene Therapy • Gene therapy – Is the alteration of an afflicted individual's genes – Holds great potential for treating disorders traceable to a single defective gene – Uses various vectors for delivery of genes into cells Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Gene therapy using a retroviral vector Cloned gene (normal allele, absent from

• Gene therapy using a retroviral vector Cloned gene (normal allele, absent from patient's cells) Retrovirus capsid 1 Insert RNA version of normal allele into retrovirus. Viral RNA 2 Let retrovirus infect bone marrow cells that have been removed from the patient and cultured. 3 Viral DNA carrying the normal allele inserts into chromosome. Bone marrow cell from patient Figure 20. 16 4 Inject engineered cells into patient. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Pharmaceutical Products • Applications of DNA technology include – Large-scale production of human hormones

Pharmaceutical Products • Applications of DNA technology include – Large-scale production of human hormones and other proteins with therapeutic uses – Production of safer vaccines Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Forensic Evidence • DNA

Forensic Evidence • DNA "fingerprints" obtained by analysis of tissue or body fluids found at crime scenes – Can provide definitive evidence that a suspect is guilty or not Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• A DNA fingerprint – Is a specific pattern of bands of RFLP

• A DNA fingerprint – Is a specific pattern of bands of RFLP markers Blood from Victim's on a gel blood (V) blood (D) clothes Defendant's defendant's 4 g D Jeans Figure 20. 17 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings 8 g shirt V

Environmental Cleanup • Genetic engineering can be used to modify the metabolism of microorganisms

Environmental Cleanup • Genetic engineering can be used to modify the metabolism of microorganisms – So that they can be used to extract minerals from the environment or degrade various types of potentially toxic waste materials Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

Agricultural Applications • DNA technology – Is being used to improve agricultural productivity and

Animal Husbandry and

– Have been engineered to be pharmaceutical

Genetic Engineering in Plants • Agricultural scientists – Have already endowed a number of

Genetic Engineering in Plants • Agricultural scientists – Have already endowed a number of crop plants with genes for desirable traits Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• The Ti plasmid – Is the most commonly used vector for introducing

• The Ti plasmid – Is the most commonly used vector for introducing new genes into plant cells APPLICATION Genes conferring useful traits, such as pest resistance, herbicide resistance, delayed ripening, and increased nutritional value, can be transferred from one plant variety or species to another using the Ti plasmid as a vector. TECHNIQUE 1 Figure 20. 19 The Ti plasmid is isolated from the bacterium Agrobacterium tumefaciens. The segment of the plasmid that integrates into the genome of host cells is called T DNA. 2 Isolated plasmids and foreign DNA containing a gene of interest are incubated with a restriction enzyme that cuts in the middle of T DNA. After base pairing occurs between the sticky ends of the plasmids and foreign DNA fragments, DNA ligase is added. Some of the resulting stable recombinant plasmids contain the gene of interest. 3 Recombinant plasmids can be introduced into cultured plant cells by electroporation. Or plasmids can be returned to Agrobacterium, which is then applied as a liquid suspension to the leaves of susceptible plants, infecting them. Once a plasmid is taken into a plant cell, its T DNA integrates into the cell's chromosomal DNA. RESULTS Transformed cells carrying the transgene of interest can regenerate complete plants that exhibit the new trait conferred by the transgene. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Agrobacterium tumefaciens Ti plasmid Site where restriction enzyme cuts DNA with the gene of interest Recombinant Ti plasmid Plant with new trait T DNA

Safety and Ethical Questions Raised by DNA Technology • The potential benefits of genetic

Safety and Ethical Questions Raised by DNA Technology • The potential benefits of genetic engineering – Must be carefully weighed against the potential hazards of creating products or developing procedures that are harmful to humans or the environment Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

• Today, most public concern about possible hazards – Centers on genetically modified